polymerization reaction buffer Search Results


taq dna polymerase  (New England Biolabs)
96
New England Biolabs taq dna polymerase
Taq Dna Polymerase, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/taq dna polymerase/product/New England Biolabs
Average 96 stars, based on 1 article reviews
taq dna polymerase - by Bioz Stars, 2026-05
96/100 stars
  Buy from Supplier
advantage 2 taq polymerase  (TaKaRa)
97
TaKaRa advantage 2 taq polymerase
Advantage 2 Taq Polymerase, supplied by TaKaRa, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/advantage 2 taq polymerase/product/TaKaRa
Average 97 stars, based on 1 article reviews
advantage 2 taq polymerase - by Bioz Stars, 2026-05
97/100 stars
  Buy from Supplier
10x pcr buffer  (Thermo Fisher)
99
Thermo Fisher 10x pcr buffer
10x Pcr Buffer, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/10x pcr buffer/product/Thermo Fisher
Average 99 stars, based on 1 article reviews
10x pcr buffer - by Bioz Stars, 2026-05
99/100 stars
  Buy from Supplier
pcr buffer  (Boehringer Mannheim)
90
Boehringer Mannheim pcr buffer
Pcr Buffer, supplied by Boehringer Mannheim, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pcr buffer/product/Boehringer Mannheim
Average 90 stars, based on 1 article reviews
pcr buffer - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier
1 3 pcr buffer  (Boehringer Mannheim)
90
Boehringer Mannheim 1 3 pcr buffer
1 3 Pcr Buffer, supplied by Boehringer Mannheim, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/1 3 pcr buffer/product/Boehringer Mannheim
Average 90 stars, based on 1 article reviews
1 3 pcr buffer - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier
10× pcr buffer  (Boehringer Mannheim)
90
Boehringer Mannheim 10× pcr buffer
10× Pcr Buffer, supplied by Boehringer Mannheim, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/10× pcr buffer/product/Boehringer Mannheim
Average 90 stars, based on 1 article reviews
10× pcr buffer - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier
10-strength pcr buffer  (Promega)
90
Promega 10-strength pcr buffer
10 Strength Pcr Buffer, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/10-strength pcr buffer/product/Promega
Average 90 stars, based on 1 article reviews
10-strength pcr buffer - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier
pcr buffer  (Thermo Fisher)
99
Thermo Fisher pcr buffer
FIG. 2. Cloning and sequencing strategy elucidates the mouse presenilin-1 gene’s exon-intron structure. A, Screening strategy: screening A utilized a fragment of the mouse <t>PS-1</t> <t>cDNA</t> as probe A (filled box) to identify lambda phage clones of the mouse PS-1 genomic DNA (represented as double lines). Screening B utilized <t>PCR</t> primers to identify a P1 clone of the mouse PS-1 gene, P1–10809, as represented by the hatched horizontal box. B, sequencing strategy: lambda phage clones and P1–10809 were restricted and subcloned into pBluescript II KS(1) vector. Thick lines correspond to individual plasmid subclones from corresponding regions of PS-1 genomic DNA found in P1–10809. Double arrows represent PCR products from the P1–10809 template that were sequenced directly. Restriction endonucleases are abbreviated as: H, HindIII; E, EcoRI; N, NotI; X, XhoI. C, exon-intron structure of the mouse PS-1 gene. Exons are boxed and double lines represent introns. Filled boxes and open boxes correspond to the protein coding and untranslated regions, respectively. The translation start codon ATG begins at position 111,420, the translation termination codon TAG is at 145,627, and the putative polyadenylation signal (AATTAA) is at position 146,612.
Pcr Buffer, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pcr buffer/product/Thermo Fisher
Average 99 stars, based on 1 article reviews
pcr buffer - by Bioz Stars, 2026-05
99/100 stars
  Buy from Supplier
taq polymerase  (New England Biolabs)
96
New England Biolabs taq polymerase
FIG. 2. Cloning and sequencing strategy elucidates the mouse presenilin-1 gene’s exon-intron structure. A, Screening strategy: screening A utilized a fragment of the mouse <t>PS-1</t> <t>cDNA</t> as probe A (filled box) to identify lambda phage clones of the mouse PS-1 genomic DNA (represented as double lines). Screening B utilized <t>PCR</t> primers to identify a P1 clone of the mouse PS-1 gene, P1–10809, as represented by the hatched horizontal box. B, sequencing strategy: lambda phage clones and P1–10809 were restricted and subcloned into pBluescript II KS(1) vector. Thick lines correspond to individual plasmid subclones from corresponding regions of PS-1 genomic DNA found in P1–10809. Double arrows represent PCR products from the P1–10809 template that were sequenced directly. Restriction endonucleases are abbreviated as: H, HindIII; E, EcoRI; N, NotI; X, XhoI. C, exon-intron structure of the mouse PS-1 gene. Exons are boxed and double lines represent introns. Filled boxes and open boxes correspond to the protein coding and untranslated regions, respectively. The translation start codon ATG begins at position 111,420, the translation termination codon TAG is at 145,627, and the putative polyadenylation signal (AATTAA) is at position 146,612.
Taq Polymerase, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/taq polymerase/product/New England Biolabs
Average 96 stars, based on 1 article reviews
taq polymerase - by Bioz Stars, 2026-05
96/100 stars
  Buy from Supplier
e coli dna polymerase i klenow buffer  (New England Biolabs)
99
New England Biolabs e coli dna polymerase i klenow buffer
FIG. 2. Cloning and sequencing strategy elucidates the mouse presenilin-1 gene’s exon-intron structure. A, Screening strategy: screening A utilized a fragment of the mouse <t>PS-1</t> <t>cDNA</t> as probe A (filled box) to identify lambda phage clones of the mouse PS-1 genomic DNA (represented as double lines). Screening B utilized <t>PCR</t> primers to identify a P1 clone of the mouse PS-1 gene, P1–10809, as represented by the hatched horizontal box. B, sequencing strategy: lambda phage clones and P1–10809 were restricted and subcloned into pBluescript II KS(1) vector. Thick lines correspond to individual plasmid subclones from corresponding regions of PS-1 genomic DNA found in P1–10809. Double arrows represent PCR products from the P1–10809 template that were sequenced directly. Restriction endonucleases are abbreviated as: H, HindIII; E, EcoRI; N, NotI; X, XhoI. C, exon-intron structure of the mouse PS-1 gene. Exons are boxed and double lines represent introns. Filled boxes and open boxes correspond to the protein coding and untranslated regions, respectively. The translation start codon ATG begins at position 111,420, the translation termination codon TAG is at 145,627, and the putative polyadenylation signal (AATTAA) is at position 146,612.
E Coli Dna Polymerase I Klenow Buffer, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/e coli dna polymerase i klenow buffer/product/New England Biolabs
Average 99 stars, based on 1 article reviews
e coli dna polymerase i klenow buffer - by Bioz Stars, 2026-05
99/100 stars
  Buy from Supplier
taq polymerase  (Promega)
90
Promega taq polymerase
FIG. 2. Cloning and sequencing strategy elucidates the mouse presenilin-1 gene’s exon-intron structure. A, Screening strategy: screening A utilized a fragment of the mouse <t>PS-1</t> <t>cDNA</t> as probe A (filled box) to identify lambda phage clones of the mouse PS-1 genomic DNA (represented as double lines). Screening B utilized <t>PCR</t> primers to identify a P1 clone of the mouse PS-1 gene, P1–10809, as represented by the hatched horizontal box. B, sequencing strategy: lambda phage clones and P1–10809 were restricted and subcloned into pBluescript II KS(1) vector. Thick lines correspond to individual plasmid subclones from corresponding regions of PS-1 genomic DNA found in P1–10809. Double arrows represent PCR products from the P1–10809 template that were sequenced directly. Restriction endonucleases are abbreviated as: H, HindIII; E, EcoRI; N, NotI; X, XhoI. C, exon-intron structure of the mouse PS-1 gene. Exons are boxed and double lines represent introns. Filled boxes and open boxes correspond to the protein coding and untranslated regions, respectively. The translation start codon ATG begins at position 111,420, the translation termination codon TAG is at 145,627, and the putative polyadenylation signal (AATTAA) is at position 146,612.
Taq Polymerase, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/taq polymerase/product/Promega
Average 90 stars, based on 1 article reviews
taq polymerase - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier
10 3 pcr buffer  (Promega)
90
Promega 10 3 pcr buffer
FIG. 2. Cloning and sequencing strategy elucidates the mouse presenilin-1 gene’s exon-intron structure. A, Screening strategy: screening A utilized a fragment of the mouse <t>PS-1</t> <t>cDNA</t> as probe A (filled box) to identify lambda phage clones of the mouse PS-1 genomic DNA (represented as double lines). Screening B utilized <t>PCR</t> primers to identify a P1 clone of the mouse PS-1 gene, P1–10809, as represented by the hatched horizontal box. B, sequencing strategy: lambda phage clones and P1–10809 were restricted and subcloned into pBluescript II KS(1) vector. Thick lines correspond to individual plasmid subclones from corresponding regions of PS-1 genomic DNA found in P1–10809. Double arrows represent PCR products from the P1–10809 template that were sequenced directly. Restriction endonucleases are abbreviated as: H, HindIII; E, EcoRI; N, NotI; X, XhoI. C, exon-intron structure of the mouse PS-1 gene. Exons are boxed and double lines represent introns. Filled boxes and open boxes correspond to the protein coding and untranslated regions, respectively. The translation start codon ATG begins at position 111,420, the translation termination codon TAG is at 145,627, and the putative polyadenylation signal (AATTAA) is at position 146,612.
10 3 Pcr Buffer, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/10 3 pcr buffer/product/Promega
Average 90 stars, based on 1 article reviews
10 3 pcr buffer - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

Image Search Results


FIG. 2. Cloning and sequencing strategy elucidates the mouse presenilin-1 gene’s exon-intron structure. A, Screening strategy: screening A utilized a fragment of the mouse PS-1 cDNA as probe A (filled box) to identify lambda phage clones of the mouse PS-1 genomic DNA (represented as double lines). Screening B utilized PCR primers to identify a P1 clone of the mouse PS-1 gene, P1–10809, as represented by the hatched horizontal box. B, sequencing strategy: lambda phage clones and P1–10809 were restricted and subcloned into pBluescript II KS(1) vector. Thick lines correspond to individual plasmid subclones from corresponding regions of PS-1 genomic DNA found in P1–10809. Double arrows represent PCR products from the P1–10809 template that were sequenced directly. Restriction endonucleases are abbreviated as: H, HindIII; E, EcoRI; N, NotI; X, XhoI. C, exon-intron structure of the mouse PS-1 gene. Exons are boxed and double lines represent introns. Filled boxes and open boxes correspond to the protein coding and untranslated regions, respectively. The translation start codon ATG begins at position 111,420, the translation termination codon TAG is at 145,627, and the putative polyadenylation signal (AATTAA) is at position 146,612.

Journal: The Journal of biological chemistry

Article Title: Transcriptional regulation of the mouse presenilin-1 gene.

doi: 10.1074/jbc.272.38.23489

Figure Lengend Snippet: FIG. 2. Cloning and sequencing strategy elucidates the mouse presenilin-1 gene’s exon-intron structure. A, Screening strategy: screening A utilized a fragment of the mouse PS-1 cDNA as probe A (filled box) to identify lambda phage clones of the mouse PS-1 genomic DNA (represented as double lines). Screening B utilized PCR primers to identify a P1 clone of the mouse PS-1 gene, P1–10809, as represented by the hatched horizontal box. B, sequencing strategy: lambda phage clones and P1–10809 were restricted and subcloned into pBluescript II KS(1) vector. Thick lines correspond to individual plasmid subclones from corresponding regions of PS-1 genomic DNA found in P1–10809. Double arrows represent PCR products from the P1–10809 template that were sequenced directly. Restriction endonucleases are abbreviated as: H, HindIII; E, EcoRI; N, NotI; X, XhoI. C, exon-intron structure of the mouse PS-1 gene. Exons are boxed and double lines represent introns. Filled boxes and open boxes correspond to the protein coding and untranslated regions, respectively. The translation start codon ATG begins at position 111,420, the translation termination codon TAG is at 145,627, and the putative polyadenylation signal (AATTAA) is at position 146,612.

Article Snippet: Briefly, a 50-ml PCR reaction containing a PS-1-specific reverse primer (TGGCTCAGGGTTGTCAAGTC, 0.2 mM), the CLONTECH AP1 adaptor primer (CCATCCTAATACGACTCACTATAGGGC, 0.2 mM), 2.5 ng of Marathon-Ready cDNA, 1 3 PCR buffer (Life Technologies, Inc.), MgCl2 (1.5 mM), dimethyl sulfoxide (5%), dATP, dGTP, dCTP, and dTTP (0.2 mM each), and Taq DNA polymerase (5 units, Life Technologies, Inc.) was used with a reaction cycle of 95 °C for 45 s, 55 °C for 30 s, and 72 °C for 90 s for a total of 30 cycles in the first amplification step.

Techniques: Cloning, Sequencing, Clone Assay, Plasmid Preparation